Sportangebot - HSP - TU Dortmund

Booking 1-225-1600 fA Mo 19:00-21:00 H2 OH3 07.04.2025-18.07.2025 Tim Burkholder entgeltfrei keine Buchung 1-225-1601 F Di Di 19:15-21:00 19:15-21:00 H2 OH3 H3 OH3 07.04.2025-18.07.2025 Finn Juri Liedtke [...] Do Do 19:00-20:30 19:00-20:30 H1 OH3 H2 OH3 07.04.2025-18.07.2025 Kai Helpenstein, Finn Juri Liedtke entgeltfrei keine Buchung 1-225-1605 fr. Sp. Fr 16:00-18:00 H1-3 OH3 07.04.2025-18.07.2025 Björn Hoffmann [...] 1-225-1602 Profis Di 21:00-23:00 H2 OH3 07.04.2025-18.07.2025 Kilian Schulte, Kai Helpenstein entgeltfrei keine Buchung 1-225-1603 A Do Do 17:30-19:00 17:30-19:00 H1 OH3 H2 OH3 07.04.2025-18.07.2025 Kai Helpenstein …

Sportangebot - HSP - TU Dortmund

freies Spiel Mo Mo 21:00-23:00 21:00-23:00 H2 OH3 H3 OH3 20.10.2025-06.02.2026 Viktor Hülsbusch nur mit Sportkarte 1-425-0101 A Di 19:15-21:00 H1 OH3 20.10.2025-06.02.2026 Mohimeen Abdelfattah nur mit [...] 1-425-0103 freies Spiel F Mi 18:30-20:30 H2 OH3 20.10.2025-06.02.2026 Hamisi Madikah nur mit Sportkarte 1-425-0104 freies Spiel Do Do 20:30-22:30 20:30-22:30 H2 OH3 H3 OH3 20.10.2025-06.02.2026 Jonas Berendes nur [...] mit Sportkarte 1-425-0105 F Fr 18:00-20:00 H1 OH3 20.10.2025-06.02.2026 Hamisi Madikah nur mit Sportkarte 1-425-0107 freies Spiel So 18:00-20:00 H3 OH3 20.10.2025-06.02.2026 Hamisi Madikah nur mit Sportkarte …

Crystallization and preliminary X-ray crystallographic analysis of SEDL

(β4) (α3) (β5) (loop) ____________________________________________________________ S2 F7 (β1) F7 (β1) I48 (loop)---α1 S21 F18 (β2) I9 (β1) V49 (loop) Y60 (β3) M20 (β2) F75 (β4) D50 (loop)---β3 K62 (β3) F22 [...] TCTGGGAGC TTCTACTTTGTAAT- 3’, and the reverse primer was 5’-GGAATTCGCTGAGCCT 63 AGCTTAAAAGGTGTTTCTTCCC-3’. For V130D, the forward primer was 5’- TCGACAGGAAAGACCAGTTTCTTGG -3’, and the reverse primer was [...] was 5’- CCAAGAAACTGGTCTTTCCTGTCGA -3’.For D47Y, the forward primer was 5’- ATGCTGCTCTTTTACCTTGTGGACG A-3’, and the reverse primer was 5’– TCGTCCACAAGGTAAAGAGCAGCAT –3’. The PCR amplifications were performed …

Endbericht der Projektgruppe 361 Dragon Slayer SWORD

Solaris und Linux in der Version 3.2 eingesetzt, unter Linux sp̈ater auch die Version 3.2.1. 2.2.3 Versionskontrolle: CVS Ein großes Software-Projekt wie Dragon Slayer 3 bedarf eines Systems zur Versio [...] 5 2.2.3 Versionskontrolle: CVS . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 2.2.4 Compiler und Debugger . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 3 The Big Picture 7 3.1 Ko [...] . . . 37 5.3.2 NetCryptedSender . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37 Beispiel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38 5.3.3 AsyncSender …

Verschlingungsinvarianten und Bandflächen eingebetteter Graphen

a basis of the linking-module for the 3-connected simple graphs is constructed. Theelements of that basis are derived from certain subgraphs homeomorphic to K3;3, K5 or disjoint circles . As an application [...] stellen Sie sich entsprechend darauf ein. Maintenance: at 2025-11-07 the system will be unavailable from 3 p.m. until 4 p.m. Please plan accordingly. English Deutsch Log In Email address Password Log in New [...] that way. These elements are used to define unique disk/band surfaces for spatial M¨obiusladders in 3-space with the help of the Gordon-Litherland-form. Up to now constructionsof unique disk/band-surfaces …

Punkt) Which set of films is the closure of {Simpsons (Film)}? 2. (3 Punkte) Last week, we have seen that with a minimum support of 3 5 , the frequent itemsets are (using the one-letter representation [...] . . , z10, in the transaction database extracted from the following table: Rep. Titel Jahr z1 z2 z3 z4 z5 z6 z7 z8 z9 z10 a Star Wars 1977 1 1 0 0 1 0 1 0 1 1 b E.T. der Ausserirdische 1982 1 1 0 1 1 [...] closure of any proper subset of S. Formally, S is free if and only if: S ′ ⊂ S ⇒ S 6⊆ closure(S ′) 3. (2 Punkte) Which of the itemsets {a, b}, {b, c}, {b, f} are free? Aufgabe 4.2 (4 Punkte) Consider the …

BzMU12_HORN_Surreal

= ({1, 2, 3, 4, …}; { }) Doch Achilles rennt weiter. Wo aber ist er, wenn er einen weiteren Schritt ω + 1 = ({1, 2, 3, 4, …, ω}; { }) gemacht hat? Und wie viele Schritte muss er machen, um 3 h zu laufen [...] Wettrennen des Achilles. Das Raumschiff hat nach zwei Stunden eine Entfernung von ω km = ({1 km, 2 km, 3 km, 4 km, …}; { }) zur Erde zurück gelegt. Aus Erdsicht ist es unendlich weit entfernt, und es fliegt [...] das Raumschiff, wenn es ω + 1 Be- schleunigungsphasen durchlaufen hat? Und wo befindet es sich nach 3 h? Rota (2008, S. 217) beschreibt eindrücklich: „Surreal numbers are an in- vention of the great John …